Table 1.

Oligonucleotides used in the DNA-binding studies

  OligonucleotideSequencea (5′–3′)
E box-1 typeACCTGAACAGATGGTCGGCT
E box-1 type mutantACCTGAACcGATtGTCGGCT
E box-2 typeTCGGCGCCAGGTGCTGCGTC-3′
c-kit (−383 to −369 nt)AGCACCTGGCAGGTGGCGG
c-kit E-1 mutantAGaACCTGGCAGGTgGCGG
c-kit E-2 mutantAGCACCTGGCAGGTgGCGG-3′
c-kit double mutantAGaACCTGGCAGGTgGCGG
  • a E boxes are underlined. Mutations are shown in lowercase.