TABLE 4

Primers used for analysis of Tcrb gene rearrangement

PrimerSequence (5′→3′)Referencea
Forward
    Vβ1GTTGATTCGAAATGAGACGGTGCCC25
    Vβ2GGAGTCCTGGGGACAAAGAGGTCA
    Vβ3GAGGTGTATCCCTGAAAAGG42
    Vβ4CCTGATATGCGAACAGTATCTAGGC25
    Vβ5CCCAGCAGATTCTCAGTCCAACAG25
    Vβ6GCGATCTATCTGAAGGCTATGATGC25
    Vβ7GTACTGGTATCGACAAGACCC42
    Vβ8GCATGGGCTGAGGCTGATCCATTA25
    Vβ9GAACAGGGAAGCTGACAC42
    Vβ10TCCAAGGCGCTTCTCACCTCAGTC25
    Vβ11TGCTGGTGTCATCCAAACACCTAG25
    Vβ12AGTTACCCAGACACCCAGACATGA25
    Vβ13CTGCTGTGAGGCCTAAAGGAACTA25
    Vβ14AGAGTCGGTGGTGCAACTGAACCT25
    Vβ15CCCATCAGTCATCCCAACTTATCC25
    Vβ16TAGGACAGCAGATGGAGTTTCTGG25
    Vβ17GCACACTGCCTTTTACTGG42
    Vβ18GGACATCTGTCAAAGTGGC42
    Vβ19CTACAAGAAACCGGGAGAAGAACTC26
    Vβ20GCCAGGAAGCAGAGATG42
    Dβ1GCTTATCTGGTGGTTTCTTCCAGC25
    Dβ2GTAGGCACCTGTGGGGAAGAAACT25
    β-actin FGGCTGTATTCCCCTCCATCG
    β-actin F nestedTGGGGTTTTCTTGGGGATCG
Reverse
    Jβ1 RCAGAGAAGAGCAAGCGACCA
    Jβ2 RTGAGAGCTGTCTCCTACTATCGATT25
    Jβ1 R nestedAAGGGACGACTCTGTCTTACCTTATACC82
    Jβ2 R nestedTTTCCCTCCCGGAGATTCCCTAA25
    β-actin RCAATTGAGAAAGGGCGTGGC
  • a Primers without a reference indicated were designed for this study.