Table 1.

Oligonucleotides used to introduce mutations into different integral RNA constructs or for PCR generation of transcription templates

PrimerSequence
164EcoU5del5′-GCGTGAATTCCTAGAATGAACGGTGGAAGGCGGCAGGCCGAGGCTTTTCCGCCCGCTGAAAGTCAGCGAAGCGCGCGGGGAGC-3′
+1EcoU4del5′-GCGTGAATTCGGGTTGCGGAGGGTGGGCCTGGGAGGGGTGGTGGCCATTTTTTGTCTAACCCTAACTGAGAAGGGCGTAGGCGCCGTGCTCCCCGCGC-3′
U6del5′-GCGTGAAATTCGGGTTGCGGAGGGTGGGCCTGGGAGGGGTGGTCTAACCCTAACTGAG-3′
451SpeI5′-GCGTACTAGTGCATGTGTGAGCCGAGTCCT-3′
+1EcoRI5′-GCGTGAATTCGGGTTGCGGAGGGTGGGCCT-3′
MTemU45′-GCTAATGAAAATCAGGGT-3′
U55′-CAGCGAGAAAAACAGCGGG-3′
U45′-GGAGAACAAAAGACCAGA-3′
T7mtemU45′-CGTAATACGACTCACTATAGGGTTAGCTGTGGGTTCT-3′
mTR+4285′-GTGAGAACCGAGTTCCGGG-3′
T7mTR+15′-CGTAATACGACTCACTATAGGGACCTAACCCTGATTTTCATTAGC-3′
+1EcoU4del5′-GCGTGAATTCGGGTTGCGGAGGGTGGGCCTGGGAGGGGTGGTGGCCATTTTTTGTCTAACCCTAACTGAGAAGGGCGTAGGCGCCGTGCTCCCCGC-3′
+164Eco5′-GCGTGAATTCAGCAAACAAAAAATGTCAGCTG-3′
EcoC3C45′-GCGTGAATTCGGGTTGCGGAGGGTGGGCCTGGGAGGGGTGGTGGCCATTCCTTGTCTAAC-3′