TABLE 3

Primers for analysis of mtDNA sequence

Mitochondrial DNA fragment (nucleotide positions)Primer sequence, 5′→3′
ForwardReverse
1 (47–1704)GCATTTGGTATTTTCGTCTGGGGAGTAAGGTGGAGTGGGTTTGG
2 (755–1914)GCATCAAGCACGCAGCAATCTGGTTTCGGGGGTCTTAGC
3 (1616–3182)ACACAAAGCACCCAACTTACACTATCATTTACGGGGGAAGGCG
4 (2414–3564)CCTCACTGTCAACCCAACACTCATAGTAGAAGAGCGATGGTG
5 (3125–5491)ACGAAAGGACAAGAGAAATAAGGCGGGGAGATAGGTAGGAGTAGCG
6 (3878–5468)CAGAGACCAACCGAACCCCGGTAAGGGCGATGAGTGTGG
7 (4950–7140)TCCATCATAGCAGGCAGTTGAGGGATTTTGGCGTAGGTTTGGTC
8 (6048–7380)GGTAACGACCACATCTACAACGCCAGGTTTATGGAGGGTTCTTC
9 (6416–7288)AAAACCCCCTGCCATAACCCAGAGAAATGAATGAGCCTACAGATG
10 (6959–8947)CCTGACTGGCATTGTATTAGCAGTATGGGGATAAGGGGTGTAGG
11 (7772–8939)ACCGTCTGAACTATCCTGCCATAAGGGGTGTAGGTGTGCC
12 (8538–10147)TCTGTTCGCTTCATTCATTGCCTAGCCGTTGAGTTGTGGTAGTC
13 (9273–9792)TCAGCCCTCCTAATGACCTCCTTGAGCCGTAGATGCCGTC
14 (9499–11209)TCTGAGCCTTTTACCACTCCAGTAGGAAGTATGTGCCTGCGTTC
15 (10291–11166)CCCTACAAACAACTAACCTGCCATCGGGTGATGATAGCCAAGG
16 (10830–12623)GAATCAACACAACCACCCACAGACGAACAATGCTACAGGGATGA
17 (11597–12407)ACAGACCTAAAATCGCTCATTGCACGAGGGTGGTAAGGATGGG
18 (11989–13568)ATTTACCACAACACAATGGGGCATAGATAGGGCTCAGGCGTTTG
19 (12801–13778)CAGTTGATGATACGCCCGAGTTGTTTGGAAGGGGGATGCG
20 (13436–14765)CTCTCACTTCAACCTCCCTCACTTTTGCGTATTGGGGTCATTGG
21 (13926–15454)TAGCATCACACACCGCACAATCAAGGAAGAGAAGTAAGCCGAGG
22 (14684–15633)CGGACTACAACCACGACCAAAGTAATAGGGCAAGGACGCC
23 (15264–16509)CCACCCTCACACGATTCTTTACAGGAACCAGATGTCGGATACAG
24 (15977–16521)CCACCATTAGCACCCAAAGCTGACCCTGAAGTAGGAACCAGA
25 (16245–382)CAACTCCAAAGCCACCCCTCGGCTGGTGTTAGGGTTCTTTG