TABLE 4

Primers for analysis of human PKD1 knockdown efficiency

TargetPrimer sequence, 5′→3′
ForwardReverse
siPKD1-1CTCAATGCCTCCAACGCAGTCAGCCAGCAGGATCTGAAAATG
siPKD1-2GCTTCACTAGCTTCGACCAGGTCGGCATAATGTCTTGCCAAAG
GAPDHCCTCAACGACCACTTTGTCATTACTCCTTGGAGGCCATGT