TABLE 1

Primers for analysis of mtDNA copy number

SpeciesGenomeTargetPrimer sequence, 5′→3′
ForwardReverse
Rattus norvegicusMitochondrialCytochrome bGCAGCTTAACATTCCGCCCAATCATACTGGTTGGCCTCCGATTCATGT
NuclearActinATCATGTTTGAGACCTTCAACACCCCATCTCTTGCTCGAAGTCTAGG
Mus musculusMitochondrialtRNA-ValCTAGAAACCCCGAAACCAAACCAGCTATCACCAAGCTCGT
Nuclearβ2-MicroglobulinATGGGAAGCCGAACATACTGCAGTCTCAGTGGGGGTGAAT
Homo sapiensMitochondrialtRNA-LeuCACCCAAGAACAGGGTTTGTTGGCCATGGGTATGTTGTTA
Nuclearβ2-MicroglobulinTGCTGTCTCCATGTTTGATGTATCTTCTCTGCTCCCCACCTCCAAGT