TABLE 2

Primers for analysis of PGC-1α RNA expression

SpeciesTargetPrimer sequence, 5′→3′
ForwardReverse
Rattus norvegicusGAPDHCAACTCCCTCAAGATTGTCAGCAAGGCATGGCATGGACTGTGGTCATGA
PGC-1αGAAAAAGCTTGACTGGCGTCGCAGCACACTCTATGTCACTC
Mus musculusGAPDHCATGGCCTTCCGTGTTCCTACCTGCTTCACCACCTTCTTGAT
PGC-1αGAAAAAGCTTGACTGGCGTCGCAGCACACTCTATGTCACTC
Homo sapiensGAPDHCCTCAACGACCACTTTGTCATTACTCCTTGGAGGCCATGT
PGC-1αGACACCCTCTTCTCTTCCTTCTTTCGGCTGTTACTCTCTCTCCTTG