TABLE 1.

Oligonucleotides used for PCR amplification of Pax3 and Pax3-FKHR sequences

NameSequencecDNAPosition (bp)
1AGTCAGATGAAGGCTCCGATATPax3896-917
2GTGTCAGATCCCAGTAGCACCGPax31257-1279
3CAAAGCACTATTCCTTCGAACGCPax31317-1340
4CTGTAGCCTGCGGTGCTATAGGPax31673-1651
5CTTATGCAATATCTGGCTTGAGAT AATGAAAGGPax32245-2213
6CTCCAAGATCATCCTGTTCGGTCPAX3-FKHR1609-1587
7AAAGTAGAGGCCATCTTTGCGGCPAX3-FKHR1667-1645
8GCACTCTTACCAGCCCACGTCTATTPax31224-1248
9CGTTGACATCCGTAAAGACCTCTAβ-actin gene780-813
10TAAAACGCAGCTCAGTAACAGTCCGβ-actin gene1076-1052