TABLE 1.

Sequences and amplification conditions for primers

GenBank accession no. and primerSequence (5′ to 3′)Map positions (bp)Length (bp)Annealing temp (°C)
Standard PCRQuantitative PCR
U63630 a
EX9-F ATGTCTTCCGGAGACTCCTGAAGC 6342-6365
EX9-R GGCCTCCTATTCTCAGAATCATGC 6705-67283875257
EX7-F TAATCCGTCACCTTGACTACCACC 8901-8924
EX7-R ACAGCACGTGCATGATTCTGTAGG 9277-930040066
EX6-F TACCTGTGGGTAAGAGATGAGTTG 10691-10704
EX6-R TGCCTGTTCCCAAATGCTATATGC 10998-1102133165
EX2-F TCTGCACTCCGTTCAGCTCCTCTG 11894-11917
EX2-R GAGTGAGGATGCCAGGTCATCTCC 12191-1221432168
UPR-F AAACCAGAAGTAGGCCTCGCTCGG 12946-12969
UPR-R1 GGCCAGTAAGCGCGCCTCTTTGG 13460-1348253762
UPR-R2 GTCTGACCTGCGGAGGTAGTTTGG 13405-1342848366
IN1-F ATCTCGCCTAATCCCACCAGTACC 14364-14387
IN2-R CATATTCACTACTAGACCCTCCGG 14633-1465629362
IN6-F GACATTCTGCTTCCATAGATGTGG 19943-19966
IN6-R GTTGGGAAAGATGTCATCATCAGG 20265-2028834655
IN7-F GAGGAATGCCAGAATTTCCAGAGG 26412-26435
IN7-R TTCCATCTGGAATGAGATCCCAGC 26118-2674132758
M94363 b
LB2C1-F GTTAACAGTCAGGCGCATGGGCC 1-23
LB2C1-R CCATCAGGGTCACCTCTGGTTCC 217-24024064
LB2-F GGCTGGCATGGACTTTCATTTCAG 3839-3862
LB2-R GTGGAGGGATCTTTCTTAGACATC 4047-407023266
LB2C2-F CACAGCATGCGGCTGCTGATCTG 6648-6670
LB2C2-R CCTGGTGCGTCCCATCTGCCTGC 6910-693228568
  • a Connelly et al. (11).

  • b Biamonti et al. (5, 6).