TABLE 1.

PCR primer sequences used to generate DP103 deletion mutants (5′ → 3′)a

DP1031F GGATCCAAATGGCGGCGGCGACG
DP103410R CTGCAGTCATGTCAGTCCCAATGTAC
DP103411F GGATCCAAGTGACCTACTGTTGTAGA
DP103456F GGATCCAAGTTAAAGCTGCCATGCAT
DP103515F GGATCCAAAAGCTTCCTGTGAAAAGC
DP103521R CTGCAGTCAGTGGCTTTTCACAGGAA
DP103547R CTGCAGTCACTTAACTTGCTCTTCCA
DP103611F GGATCCAAGTGGAAATTATCCGGCAC
DP103617R CTGCAGTCAGTAGTGCCGGATAATTT
DP103721F GGATCCAAAAGGCAAGGCATAAAGAA
DP103727R CTGCAGTCAGCCTTCTTTATGCCTTG
DP103825R CTGCAGTCATTGGTTACCACGCATCA
  • a Numbers denote first (F) or last (R) amino acid in fragment.