TABLE 1.

Primer pairs used in this study

SiteSequence
β-Major promoterGACAAACATTATTCAGAGGGAGTACCC, AGGTGCACCATGATGTCTGTTTCTGG
HS1GCCTTACATCCCTGGACAGATAAAC, GTGACATTGTGAGAAACTGAGACCC
HS2TTCCTACACATTAACGAGCCTCTGC, AACATCTGGCCACACACCCTAAGC
HS3TGTTTCCCTGATGAGGATTCAATGG, CCCACACATGGTCATCTATCTGAGC
HS4CCCTCTCTTACATCTAGCAGCAATG, GCATGAAGTTCCTGCCTCTAAATC
εyCAAAGAGAGTTTTTGTTGAAGGAGGAG, AAAGTTCACCATGATGGCAAGTCTGG
βH1CAAGGTCCAGGGTGAAGAATAAAAGG, CAGGAGCCTAAGACATAGTGCATTAGC
NecdinTTTACATAAGCCTAGTGGTACCCTTCC, ATCGCTGTCCTGCATCTCACAGTCG