TABLE 1.

Primers used in this worka

PrimerSequence
Diagnostic PCR
    1 (Forward)TGACTGGAGCGAGGCGAT
    2 (Reverse)GCAGTAGCGTGGGCATTT
    3 (Reverse)TCAGAGCAGCCGATTGTCT
Competitive PCR
    Hyg ForwardTGTAGGAGGGCGTGGATA
    Hyg ReverseGGGCAGTTCGGTTTCAGGCAG
    Hyg Forward CompetitorTGTAGGAGGGCGTGGATAATGGTTTCTATAAAGATC
    TK ForwardCGGCGGTGGTAATGACAAG
    TK ReverseGCAAGGTCGGCGGGATGAG
    TK Reverse CompetitorGCAAGGTCGGCGGGATGAGCCTGGGGGGTCATGCTG
    pML ForwardTCGCCGCACTTATGACTGT
    pML ReverseCCTGCTTCTCGCCGAAAC
    pML Reverse CompetitorCCTGCTTCTCGCCGAAACACGAAGGCTTGAGCGAGG
Q-PCR
    Hyg ForwardTGCTCCGCATTGGTCTTGA
    Hyg ReverseTGCGCCCAAGCTGCAT
    pVU ForwardCCAAAGCGGTCGGACAGT
    pVU ReverseGCGCTATATGCGTTGATGCA
    pML ForwardTCGACCGATGCCCTTGAG
    pML ReverseTCATAAGTGCGGCGACGATA
    TK ForwardAGCAAGAAGCCACGGAAGTC
    TK ReverseGTTGCGTGGTGGTGGTTTTC
    54.8 ForwardAAACCCTGCTTATCTTAAACCAACC
    54.8 ReverseACTCTGCCCTGCCTTTTATGC
  • a Competitor oligonucleotides were used to prepare templates containing deletions of ∼20 bp from wild-type templates that could be amplified with wild-type forward and reverse primers (40).