TABLE 1.

Induction of DNA methylation in N. crassa by synthetic DNA fragmentsa

Plasmid designationN. crassa strain(s) with targeted sequence(s)Length tested (bp)Insert sequenceRepeat unit or featureMethylationb (%)
MeanSD
pHT1N230126AATAAATAAATAAATTTTTTAAAATARandom, 100% A:T37.01.8
TTATTTATTTATTTAAAAAATTTTAT
pHT2N230225TTTTTTAATTTTATTTTAAATTTTTRandom, 100% A:T6.61.2
AAAAAATTAAAATAAAATTTAAAAA
pHT3N230324AATTTTTTATTTATTATATAATTTRandom, 100% A:T3.21.3
TTAAAAAATAAATAATATATTAAA
pHT4N230423TAAAAATTAAAATAATTAAAAAARandom, 100% A:T6.81.1
ATTTTTAATTTTATTAATTTTTT
pHT5N230525ATTTTAAAAAAAATATATTAATAAARandom, 100% A:T14.50.1
TAAAATTTTTTTTATATAATTATTT
pHT6N230624ATTATATATTTTATTAATTTTTTTRandom, 100% A:T6.30.9
TAATATATAAAATAATTAAAAAAA
pHT7N230725TTATTATTTAAATTTTAAATAAATTRandom, 100% A:T15.22.8
AATAATAAATTTAAAATTTATTTAA
pHT8N230825TAAATTTAATAAATTTATTTTTAATRandom, 100% A:T27.08.1
ATTTAAATTATTTAAATAAAAATTA
pHT9N230923TAAAAATTAAAATAATTAAAAAARandom, 100% A:T9.02.9
ATTTTTAATTTTATTAATTTTTT
pHT10N231025TTTATTTAAATTTATAATAATTATARandom, 100% A:T14.70.7
AAATAAATTTAAATATTATTAATAT
pHT11N231125TATTATAATATTTATAATTATTTTTRandom, 100% A:T8.71.1
ATAATATTATAAATATTAATAAAAA
pHT12N231225TATTATAATATTTATAATTATTTTTRandom, 100% A:T5.70.2
ATAATATTATAAATATTAATAAAAA
pHT13N231325AAATAATAAAAAAATATTTTTTTAARandom, 100% A:T9.01.5
TTTATTATTTTTTTATAAAAAAATT
pHT14N231425TAAAATATTATTTATATTAATAAAARandom, 100% A:T7.10.7
ATTTTATAATAAATATAATTATTTT
pHT15N231525AATAAAAAATAAATAATTATAATAARandom, 100% A:T12.13.8
TTATTTTTTATTTATTAATATTATT
pHT16N231625AAAATTTTAAATATATAATAATAATRandom, 100% A:T16.25.7
TTTTAAAATTTATATATTATTATTA
pHT17N231725AATAAAAATATTTTTATTTATAAAARandom, 100% A:T7.42.8
TTATTTTTATAAAAATAAATATTTT
pHT18N231825TAATATATATAAAAAATATAAATTARandom, 100% A:T6.12.3
ATTATATATATTTTTTATATTTAAT
pHT19N231925TATAAATTTATTTATATAATTAAAARandom, 100% A:T12.20.6
ATATTTAAATAAATATATTAATTTT
pHT20N232025GTAGGACTTACACCACCTGCGGGTCRandom, 50% G:C0.0
CATCCTGAATGTGGTGGACGCCCAG
pHT21N232123GGACGACCCGATACCACGCGACARandom, 50% G:C0.0
CCTGCTGGGCTATGGTGCGCTGT
pHT22N232225CGCAGTTGCCCCAAATAGGAGGGATRandom, 50% G:C0.0
GCGTCAACGGGGTTTATCCTCCCTA
pHT23N232325CACCAGCATCATGGTGCGCCTCAAGRandom, 50% G:C0.0
GTGGTCGTAGTACCACGCGGAGTTC
pHT24N232424CGGTGACGGTGAACAAGCTCAACARandom, 50% G:C0.0
GCCACTGCCACTTGTTCGAGTTGT
pHT25N232525GACTCGTGCCAAGTCTTCAAGGTCCRandom, 50% G:C0.0
CTGAGCACGGTTCAGAAGTTCCAGG
pHT26N232621TAGCGGAGATCACCCCCAATCRandom, 50% G:C0.0
ATCGCCTCTAGTGGGGGTTAG
pHT27N232725GGTAGCCACGGGCCTTGCCAAGCTTRandom, 50% G:C0.0
CCATCGGTGCCCGGAACGGTTCGAA
pHT28N232825TATCCAGACGGACACACGGCAACTTRandom, 50% G:C0.0
ATAGGTCTGCCTGTGTGCCGTTGAA
pHT29N232924TTTCGCTCTGCGCGGCTCATAAATRandom, 50% G:C0.0
AAAGCGAGACGCGCCGAGTATTTA
pHT30N233025TGGGCCGGCGAAGTTGGTAGAGGGTRandom, 50% G:C0.0
ACCCGGCCGCTTCAACCATCTCCCA
pHT31N233125CTGCACACGTCATAATCCTGGGAGGRandom, 50% G:C0.0
GACGTGTGCAGTATTAGGACCCTCC
pHT32N233225AAAAAAAAAAAAAAAAAAAAAAAAAA2.10.6
N2333TTTTTTTTTTTTTTTTTTTTTTTTTT
pHT33N233425AATAAAAAATAAAAAATAAAAAATATAAAAAA10.20.7
N2335TTATTTTTTATTTTTTATTTTTTATATTTTTT
pHT34N233625AATAAAAATAAAAATAAAAATAAAATAAAAA10.41.3
N2337TTATTTTTATTTTTATTTTTATTTTATTTTT
pHT35N233825AATAAAATAAAATAAAATAAAATAATAAAA12.81.6
N2339TTATTTTATTTTATTTTATTTTATTATTTT
pHT36N234025AATAAATAAATAAATAAATAAATAATAAA29.74.3
N2341TTATTTATTTATTTATTTATTTATTATTT/PICK>
Plasmid designationN. crassa strain(s) with targeted sequence(s)Length tested (bp)Insert sequenceRepeat unit or featureMethylationb (%)
MeanSD
pHT37N234225AATTAATTAATTAATTAATTAATTAAATT24.91.8
N2343TTAATTAATTAATTAATTAATTAATTTAA
pHT38N234425AATAATAATAATAATAATAATAATATAA10.81.0
N2345TTATTATTATTATTATTATTATTATATT
pHT39N234625AATATATATATATATATATATATATTA5.82.2
N2347TTATATATATATATATATATATATATATAAT
pHT40N234820TAAATAAATAAATAAATAAATAAA11.45.2
N2349ATTTATTTATTTATTTATTTATTT
pHT41N235040TAAATAAATAAATAAATAAA...TAAA74.45.9
N2351ATTTATTTATTTATTTATTT...ATTT
pHT42N235280TAAATAAATAAATAAATAAATAAAT...TAAA81.41.3
N2353ATTTATTTATTTATTTATTTATTTA...ATTT
pHT43N235425TAAAATAAAATAAAATAAAATAAAATAAAA11.60.2
N2355ATTTTATTTTTATTTTATTTTTATTTTATTTT
pHT44N235625CTAAACTAAACTAAACTAAACTAAACTAAA1.50.2
N2357GATTTGATTTGATTTGATTTGATTTGATTT
pHT45N235825CAAATCAAATCAAATCAAATCAAATTCAAA1.20.1
N2359GTTTAGTTTAGTTTAGTTTAGTTTAAGTTT
pHT46N236025CAATACAATACAATACAATACAATATACAA0.50.1
N2361GTTATGTTATGTTATGTTATGTTATATGTT
pHT47N236225CATAACATAACATAACATAACATAATAACA0.30.2
N2363GTATTGTATTGTATTGTATTGTATTATTGT
pHT48N2364100CAAAACAAAACAAAACAAAACAAAA...CAAAA4.21.3
N2365GTTTTGTTTTGTTTTGTTTTGTTTT...GTTTT
pHT49N2366100CTAAACTAAACTAAACTAAACTAAA...CTAAA63.76.6
N2367GATTTGATTTGATTTGATTTGATTT...GATTT
pHT50N2368100CAAATCAAATCAAATCAAATCAAAT...TCAAA86.26.2
N2369GTTAGTTTAGTTTAGTTTAGTTTA...AGTTT
pHT51N2370100GAAATGAAATGAAATGAAATGAAAT...TGAAA8.01.2
N2371CTTTACTTTACTTTACTTTACTTTA...ACTTT
pHT52N2372100CAATACAATACAATACAATACAATA...TACAA34.88.3
N2373GTTATGTTATGTTATGTTATGTTAT...ATGTT
pHT53N2374100CATAACATAACATAACATAACATAA...TAACA5.20.3
N2375GTATTGTATTGTATTGTATTGTATT...ATTGT
pHT54N2376100CTAATCTAATCTAATCTAATCTAAT...CTAAT24.410.5
N2377GATTAGATTAGATTAGATTAGATTA...GATTA
pHT55N2378100CTAAAACTAAAACTAAAACTAAAAA...CTAAAA74.71.3
N2379GATTTTGATTTTGATTTTGATTTTT...GATTTT
pHT56N2380100TCAAAATCAAAATCAAAATCAAAAT...TCAAAA70.64.9
N2381AGTTTTAGTTTTAGTTTTAGTTTTA...AGTTTT
pHT57N2382100CAAACAAACAAACAAACAAACAAAC...CAAA1.330.7
N2383GTTTGTTTGTTTGTTTGTTTGTTTG...GTTT
pHT58N2384100CTAACTAACTAACTAACTAACTAAC...CTAA22.23.4
N2385GATTGATTGATTGATTGATTGATTG...GATT
pHT59N2386100CAATCAATCAATCAATCAATCAATC...TCAA45.36.7
N2387GTTAGTTAGTTAGTTAGTTAGTTAG...AGTT
pHT60N2388100CTTACTTACTTACTTACTTACTTAC...GTAA10.91.5
N2389GAATGAATGAATGAATGAATGAATG...CATT
pHT61N2390100CATTCATTCATTCATTCATTCATTC...TGAA0.70.4
N2391GTAAGTAAGTAAGTAAGTAAGTAAG...ACTT
pHT62N2392100CTATCTATCTATCTATCTATCTATC...CTAT9.11.6
N2393GATAGATAGATAGATAGATAGATAG...GATA
pHT63N2394100CAACAACAACAACAACAACAACAAC...CAA0.0
N2395GTTGTTGTTGTTGTTGTTGTTGTTG...GTT
pHT64N2396100CTTCTTCTTCTTCTTCTTCTTCTTC...GAA0.20.1
N2397GAAGAAGAAGAAGAAGAAGAAGAAG...CTT
pHT65N2398100CTACTACTACTACTACTACTACTAC...CTA32.36.0
N2399GATGATGATGATGATGATGATGATG...GAT
pHT66N2400100CATCATCATCATCATCATCATCATC...CAT0.0
N2401GTAGTAGTAGTAGTAGTAGTAGTAG...GTA
pHT67N2402100GATCGATCGATCGATCGATCGATCG...GATC5.70.8
N2403CTAGCTAGCTAGCTAGCTAGCTAGC...CTAG
pHT68N2404100CATGCATGCATGCATGCATGCATGC...CATG0.0
N2405GTACGTACGTACGTACGTACGTACG...GTAC
pHT69N2406100CTAGCTAGCTAGCTAGCTAGCTAGC...CTAG1.70.4
N2407GATCGATCGATCGATCGATCGATCG...GATC
  • a Sequences tested are presented 5′ to 3′ on the top strand and 3′ to 5′ on the bottom strand. For sequences longer than 25 bp, three dots indicate that part of the test sequence is not shown. Sequences that were synthesized by incorporating a nucleotide at random from a 1:1 mixture of dATP and dTTP or from a 1:1:1:1 mixture of dGTP, dCTP, dATP, and dTTP are designated random 100% A:T and random 50% A:T, respectively.

  • b Means and standard deviations are shown. In the case of plasmids pHT1 to pHT31, these values were based on two or more independent Southern hybridizations from each of two independent cultures of the corresponding targeted transformant. All others were based on two or more independent targeted transformants (two cultures each). 0.0, no methylation detected.