TABLE 1.

Primers used in this study for real-time quantitative RT-PCR

Gene productProduct size (bp)Forward primerReverse primer
A1168GGGAAGATGGCTGAGTCTGAGCTCATGTGACTTCAGATTCTTTTCAACTTC
Bad233CCACCAACAGCTATCATGGAGGCGCGCTCTTTGGGCGAGGAAGTCCCTTG
Bax162AATATGGAGCTGCAGAGGATGATTGGCACTTTAGTGCACAGGGCCTTGAG
Bcl-2261GTGGTGGAGGAACTCTTCAGGGATGGGTCTTCAGAGACAGCCAGGAGAAATC
Bcl-xL293GTAGTGAATGAACTCTTTCGGGATGGACCAGCCACAGTCATGCCCGTCAGG
BimEL324AGTGGGTATTTCTCTTTTGACACAGTCAATGCCTTCTCCATACCAGACG
Bim(si)119AATGTCTGACTCTGACTCTCGGACTCTCCGCAGGCTGCAATTGTCTAC
Mcl-1259GTAATGGTCCATGTTTTCAAAGATGAAGCCAGCAGCACATTTCTGATGCC
DP5/Hrk189AGACCCAGCCCGGACCGAGCAAAATAGCACTGGGGTGGCTCT
28S rRNA324ACGCAGGTGTCCTAAGGCGAGCTCCACGACGGTCTAAACCCAGCTCAC