TABLE 1.

PCR primers used to isolate Phr1 cDNA

Primer pairProduct size (bp)Sequence
ForwardReverse
Phr1.F1.2-Phr1.R1.1 2,641GCAGCCGCCACCATCTCTTCCGCTGAGCTGGATGGGATCTGAG
Phr1.F2-Phr1.R2 3,000GTTGCAAGGCATGTGCAAGAGGCTATGTCACTGGGTGAATCG
Phr1.F3-Phr1.R3 3,792GGAGGTGTTGGTTGATGATAGTGCCTTCATCCACACTCTTCAAGTC
Phr1.F4-Phr1.R4 2,204GTGAGGTAGTTGAAGTCTGTACCATCATAAGGTCAGAGATGGTC
Phr1.F5-Phr1.R5 3,652CTTGCCGTGTGTTTGCAATGGCATCCTTCTCAGTCCATGAGC